Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_423F1-3
Clone ID CMHD-GT_423F1-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_423F1-3
Sequence
GTACTGGATCTCAGCCTTCCCAGCAGAGTTCGACTTGAACCCAGAGCTGGCTGAACAGATCAAGGAGCTGAAGGCTCTGT
TAGACCAAGAAGGGAACCGCAGGCACAGCAGCCTCATCGACATCGAGAGTGTGTGCGTGGGGGCGGAGCGCAAGGGGCAC
TACGCATGCTACACCATATGTGCTTAATAAATGTCTGTTCAATTG
Sequence Type mRNA
Unitrap ID UNI28800

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6403432..6403636 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]

 
Come back to gene ENSMUSG00000032946


For any suggestions or comments, please send an email to unitrap@crg.es