Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_435B12-3
Clone ID CMHD-GT_435B12-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_435B12-3
Sequence
GAGGGAGGCCTGCCTGCCTTTCTGGAGAATTCCTTCATTGGAGCTGCCCGAGAGCAGCTACTAGAAGCCCTTCAGGACTT
GAAACTTCTGGATCCTGGCATTATTGCAAAACTCAAGATCCCAGATTCTAAGTAGAATCGGACCAGCATGGGACCCCTGG
AACCCAGAGGGCCTTGGTATGAGGGAGGGAAGGACAAGTGGTCTCTCTTTGGGGTCTAAAGGATTGTAGGTGCTGCCAGA
TTAGCAACAGGGAAGGATATGCACTGTTTTCAACGGAAGACCTTGTCTGGTGGCATTAGGGATAAAAGGCCTTTTTAGTA
TCCCAGAGTCCCGCCTTATACATGGACAAACAGCCTGGAAGCTCCAGGTATGTATATGTTTAGTTCGTGGTCACACACAG
CCTGACACACTGTCATCTGCCCAGTTTAACCATGATGTGGCATTTGGCACATCCCACTCCTTCCGGGTAAATGGGAGGGT
TTCTTCCCCATCTGCTGTAAGGCTGCTGTCCTGTGTCCAGCCCAACCCATGCCTGTTAGGGAAGCAAAGGAGATGGCTTC
TTTCTGAGAATTGTCCTGTGTTACCTGGGGCTTGAGCAGAGCAGTGGGTTTCAGAAAGTGACGTAAGGGCCTACCCAGCC
CTGCGCTCTAACTGAGAGTTGGAATTGTCAAGGGCTTCTTAGGAGGCCTGAGACCTCAGTCCTGATACCTGTCTTCCTGC
GTGTTCATCTTTGAGCTCCCATTGTCTCTGT
Sequence Type mRNA
Unitrap ID UNI30379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105032046..105032795 731
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032565 (Nudt16) NM_029385 nudix (nucleoside diphosphate linked moiety X)-type motif 16 Gene [Source:MGI Symbol;Acc:MGI:1922936]

 
Come back to gene ENSMUSG00000032565


For any suggestions or comments, please send an email to unitrap@crg.es