Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_432H5-3
Clone ID CMHD-GT_432H5-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_432H5-3
Sequence
GACGAGTCAAGGGTGTGTCCACATCACTAGTGGCTCAGAC
Sequence Type mRNA
Unitrap ID UNI27732

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89658453..89658491 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046280 (She) NM_172530 src homology 2 domain-containing transforming protein E Gene [Source:MGI Symbol;Acc:MGI:1099462]

 
Come back to gene ENSMUSG00000046280


For any suggestions or comments, please send an email to unitrap@crg.es