Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_432D6-3
Clone ID CMHD-GT_432D6-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_432D6-3
Sequence
GTATAAGAACCTGGTGCCTATAAATGTCCATGCAAACCCGGGAAAGTACATCATTGAAAGCCGATACGGAATGCATACTC
TTGAGATCAGCAAGTAAGAACACACCAGAGTCTGGTGTATGTCACCACCAGACACCCCACGAGCACACCAGTGTGTGTGT
GTGTGATCACCAGACACTCCAAGAGCACATCATTGTGTGTGTGTGTGATATCACCAGACACCCCAAGAACACACCAGTGT
GTGTGTGAGACAACCACACACTCCAAAAGCACACCAGTGTGTGTGTGCGTCACCATAAGACAGTGTATCACAAATGAAAC
TAATTAAACCC
Sequence Type mRNA
Unitrap ID UNI30387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71393826..71394155 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024049 (Myom1) NM_010867 myomesin 1 Gene [Source:MGI Symbol;Acc:MGI:1341430]

 
Come back to gene ENSMUSG00000024049


For any suggestions or comments, please send an email to unitrap@crg.es