Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_417A8-3
Clone ID CMHD-GT_417A8-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_417A8-3
Sequence
TTGCAACAGACAGAGGCGGAGCTCAGGAAGGTGGATGAGGCCATCGCCCTGTTCCAGAAGATGCTGTGACCCCCCATTCC
AACCCTCAGCCCCCAGTGTTCCATCAACAGGGATGGCAGCAATAAAATATTTTCCCAAC
Sequence Type mRNA
Unitrap ID UNI30388

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35153132..35153270 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es