Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_415B6-3
Clone ID CMHD-GT_415B6-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_415B6-3
Sequence
GATGCTCCGGGTGCCCTCATGGGAGGTCTGCTGCTGTGACCGCAAGTTGATGATGTCATCCTGCTCAGACAGACGAGAAC
CAGTAGGGAGAAGATGGGAGTTGCCCTCATCCACTGTATCCAACCCTACTCCATGTGGGGTAACCCATCAAGGAGTCGCC
CCCGTCCCCACCTTCTCCTCAGGCGTTCTATTCTTCATCCTCTGAGAATCATCTAGAACTATCTAGTGCAGCAGCTCTCA
ACCTTCCTAATGCCTCGACCCTTTAATATAGTTCCTTCATGTCGTGGTGACTCCCCAAACATAAAATTATTTCTGTCGCT
ACTTC
Sequence Type mRNA
Unitrap ID UNI13867

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122563158..122563481 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013936 (Myl2) NM_010861 myosin, light polypeptide 2, regulatory, cardiac, slow Gene [Source:MGI (curated);Acc:Myl2-012]

 
Come back to gene ENSMUSG00000013936


For any suggestions or comments, please send an email to unitrap@crg.es