Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_415G12-3
Clone ID CMHD-GT_415G12-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_415G12-3
Sequence
TTCCATCCATGGAAATACAAAAGAGCTTCGGCAGATGGCAGCCAACCGAGAGGTGCCCCGGCCTCTTTCCACCTTGCCCA
TGTTTAATGTTCGTACAGGAGAGCGGTTACCTCCCCGAGTAGACAGCGCACAGATGCCTCTTATCCTGGACCAGCACTGA
AAGCCCTGCCAAGATGGGTATGTCTAGGCAGTGCTACCCCCCACCCCCAACCAAGAAATAAAGGAGCCTTTATCTCAAGG
CTGGGGTCAATTGGTAGGATATGGGAGATCACACCTACCTGCCTGCCCCCATGCACAGGTGCTCACAGTACTGGAACTGT
GCCACAACTGCCAACCAGTCAGGGCTGGAGGGTCAGGATAAGGGAGAGAGGATTCTGGAACCTCCCACTCTGTCCTCTAC
ATGACCTTGTAGCTCCAGCTCCAGCTGCACCACTCAGAGATGCTGACCTGTGAATATGTCTACAACTGACTCCAGCTCCT
AGCCTACTTGGACCTCCGGCTCCACAAAGGCAGACAGATGGTGTAGGGAGGGCTGAGGGCATTTGGAGTCAGCACCCAAA
AATAAAAAAAATACCTGCTGCTTCTGC
Sequence Type mRNA
Unitrap ID UNI13932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94824106..94824692 581
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001508 (Sgca) NM_009161 sarcoglycan, alpha (dystrophin-associated glycoprotein) Gene [Source:MGI (curated);Acc:Sgca-001]

 
Come back to gene ENSMUSG00000001508


For any suggestions or comments, please send an email to unitrap@crg.es