Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_414B9-3
Clone ID CMHD-GT_414B9-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_414B9-3
Sequence
GCTGATCATCTGCCCCAGAGGTTACATCAATTGAACTTTTAATTAAGTTCTGCTGATTCCTTGCTCCTGTATCTTCAGTG
AAATGTGCCTTGTGCTCCCACACGTCATCAACCTAAAAAGAAGTCCTTAGTGAGGATAAACTAGTGTTTCATAATTTTGT
TTCCTTTTTCTCTTTCTTCAGTTCCTTCTGTATTCAAGGGGTTAAGGAACCCAGGGCAATTATCTTGGAGACGTAATTTT
TCTGGATATCAATCAATAAAAGCAAATATGATTTG
Sequence Type mRNA
Unitrap ID UNI29029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 98907211..98907485 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044860 (Gm1123) NM_001080776 gene model 1123, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685969]

 
Come back to gene ENSMUSG00000044860


For any suggestions or comments, please send an email to unitrap@crg.es