Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G055G12
Clone ID G055G12
Vector U3CEO
Project ggtc

Sequence tag G055G12
Sequence
GTCAATGGGATCGCCTCTAATCCCTGCCTGAACCAAGCTGCCTGCCATGACCTGCTCAACGGCTTCCAGTGCCTCTGCCT
TCCTGGATTCACCGGCGCCCGATGTGAGAAAGACATGGACGAGTGTAGCAGCACCCCCTGTGCCAATGGGGGGCGCTGCC
GAGACCAGCCTGGAGCCTTCTACTGCGAGTGTCTCCCAGGCTTTGAAGGGCCACACTGTGAGAAAGAAGTGGACGAATGT
CTGACGCTGACCCCTGCCCCGTGGGAGCCAGCTTGCCCGTNGAGTACTCCCCGGACGNNCGTCGTCTGCCGTCAGCCGGT
CCCGNNNCCCCGACGAGGTTGCCGCGTCCCCCGGGGAGGANNNTACGAAGTGCCCCGGAAGAAC
Sequence Type mRNA
Unitrap ID UNI10535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34709418..34709694 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015468 (Notch4) NM_010929 Notch gene homolog 4 (Drosophila) Gene [Source:MGI (curated);Acc:Notch4-001]

 
Come back to gene ENSMUSG00000015468


For any suggestions or comments, please send an email to unitrap@crg.es