Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_416A11-3
Clone ID CMHD-GT_416A11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_416A11-3
Sequence
TGATCCTGCTGCATGCTTCACTGCGTCTGAGAAACCTTAAAAACAAGATTGAGAACAAGATCGAGAGCATCGGTCTAAAG
CGGACACCAATGGGATTGCTTCTAGAGGCACTGGGACAGGAGCAGGAAGCTGGATCCTAGGACCTTGGCATCTACACCCT
GGACGTAGAGGACCCCCACCCCATACCCAAGACCAACCCTTTTCCTAGCCATTAAAATAGGTGCCTAGAGTCCTCTGGCC
TGGCCAAAAAGAAACACCTGTGATTGATCACTGCTACCCCAAACTAGTCATCTCTTAGCCTCCAGCCCCTGGTTACCTAG
GGACCAAAGTCTTCCTCGGTCCTGAATTTGAGACTCAGTCACCTACTTCCAGTCTTGAAACTGGGACTTTTAAGCCAGAG
CATCTGTGGCCAATCTCAAAACTGGACCCCAAGATACTCCTCTGACCCAAATGTGGGACTCACTAGTCTTCCATACGTCA
AAGCTAGGCCCTAAGGCAGGACATTCTCAAATCTTGAGCTCTAAAGATTTTTCAGACCCCACACAGCTTGGAATATAGGT
TATAAGACCTGGCCAAATCTTGAGCCTAATGAGTCCACACTGAGCCCTTAACCCCAGACGACCCTAGCCCTCAGCAGTCC
CAATAGCCTCCCTCCAACCGTTAAGAGGGTCTCTTCCTCCCTCACAGTGTTCTCAGTATCAAGGACCAACATGTGGGGCT
GGCTAGGGATAGCCCC
Sequence Type mRNA
Unitrap ID UNI17677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7307394..7308127 722
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031149 (Praf2) NM_138602 PRA1 domain family 2 Gene [Source:MGI (curated);Acc:Praf2-001]

 
Come back to gene ENSMUSG00000031149


For any suggestions or comments, please send an email to unitrap@crg.es