Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_405H7-3
Clone ID CMHD-GT_405H7-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_405H7-3
Sequence
GTGACCTTTGAAAGTTAACAGGGGTGCCATGGAGCTGAGTAAGATAAACGGAACTGCTGTTCAACCCCGCCCAGTCTGGG
GATGAGTCATTGTTTTCAAATTTATGAACAAAGCACACAAATTAAGAATAATACAAGCAAGAAACAGCAGAGAGACACAA
AAGGACATAGAATCCCTGATCCTCACTGTGATCTGGTAACACTAGTTCTAGGGCTGGAGAGAGAGATGCTCAGGGCAAGT
GCTCTTACAGAGAACATGAGTTCAATTCCCAGAACCCACATGGTACCTCACAACTGCCTATTTCATACATGTGGGGCAGA
ACACCGATACACATACTTTTTTTTTTAAAAATTG
Sequence Type mRNA
Unitrap ID UNI18914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153168248..153168600 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073236 (2500004C02Rik) RIKEN cDNA 2500004C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919576]

 
Come back to gene ENSMUSG00000073236


For any suggestions or comments, please send an email to unitrap@crg.es