Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_400C5-3
Clone ID CMHD-GT_400C5-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_400C5-3
Sequence
GTCCAGAAGGATGCAGATGCTGTGGACAAGGTAATGAAGGAACTGGATGAAAACGGAGATGGGGAAGTGGACTTCAAGGA
GTATGTTGTGCTGGTGGCTGCTCTCACAGTGGCTTGTAACAACTTCTTCTGGGAGACCAGTTGAGCACAGTCTGTGAGCA
GTGCCCTTCCTCTCCCACTTGTCAAGATTTCCCCTTTAGCGTGCTTGCTCCTCACCCCACCTGTACCTCCCTATGTCCCC
ATCCTTGCCCAGTCTCGACGTGCACCAAGGGCACAAGAGTGGCAGTCCAGATCTGCCACTTGTTTTAATAAAGCCTTCTC
TCTCACC
Sequence Type mRNA
Unitrap ID UNI28547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90314960..90315286 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044080 (S100a1) NM_011309 S100 calcium binding protein A1 Gene [Source:MGI (curated);Acc:S100a1-001]

 
Come back to gene ENSMUSG00000044080


For any suggestions or comments, please send an email to unitrap@crg.es