Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_399F7-3
Clone ID CMHD-GT_399F7-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_399F7-3
Sequence
TTGACAGCTGGACTATGTAAATGTGCTTCGTGTGGGCCCAAAAGTGGAGTAACATTTGAACCTTGTATGATTTAAATTTA
CCAATCATAAGCTTGCAAGGAGGTGACCTGTAATCCCAGCACTCAGAAGGCAGAGGCAGCATATCTTGAAAAACTCAAAT
AAATAAAAAAACAAACAAGG
Sequence Type mRNA
Unitrap ID UNI14054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32971363..32971541 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021907 (Msmb) NM_020597 beta-microseminoprotein Gene [Source:MGI (curated);Acc:Msmb-001]

 
Come back to gene ENSMUSG00000021907


For any suggestions or comments, please send an email to unitrap@crg.es