Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_401C6-3
Clone ID CMHD-GT_401C6-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_401C6-3
Sequence
GACAAAGCCAAAAAGAGAAGGAAGCATAAGAAGCACAGCAAG
Sequence Type mRNA
Unitrap ID UNI30397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3568987..3569028 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058503 (5830415L20Rik) NM_001042501 RIKEN cDNA 5830415L20 gene Gene [Source:MGI Symbol;Acc:MGI:1915402]

 
Come back to gene ENSMUSG00000058503


For any suggestions or comments, please send an email to unitrap@crg.es