Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_401A2-3
Clone ID CMHD-GT_401A2-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_401A2-3
Sequence
TGCCATCTCTGCAGACTCTGTGCCGACTAGTGATCCAGAAGAGGGTGGTACACAGGCTGGCCATTGATGTGCTCCACCTG
CCCAAAGGACTGAAGGACTTCTGCAAGTACGAATGAACGAATGAACGCCTGTCTGTGGCCACCAGAGCAAAGTCCCCGGT
GGTGCGCCCTGCCTCTAGAGAAGTGGCTAGACTGAAGCTGGTCGCACAGCTCACAATCAGGGCTGGAAATAAATAGAGCC
GATGTGGATGTTCTG
Sequence Type mRNA
Unitrap ID UNI14096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164656233..164656487 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039873 (Neurl2) NM_001082974 neuralized-like 2 (Drosophila) Gene [Source:MGI (curated);Acc:Neurl2-001]

 
Come back to gene ENSMUSG00000039873


For any suggestions or comments, please send an email to unitrap@crg.es