Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_399G11-3
Clone ID CMHD-GT_399G11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_399G11-3
Sequence
GACGTTGAAGGATCATGAGGTAAAACACTTGAAAAGGGCTTACAACGAGTAGTTGACAACGGAACTGGAGGAGGCTGAGC
GGTGGCGGACAAGAGTGCCTAAGAGCAGCTGCTCTCCTGAGACCTGAGGGGAGCGGCATTCAGAAGCACCTGTTGTGAGG
GGCACAGAGCTGGTGGGCCTGTACTGAAACTCCCTGCCAGTGGCCTGATGAACTGCTTAGGACACCTATTCATGGGAGGG
ACGGGTGTGCCCATTGCATTGGGCAAATGCATCCCATTTGTCTTCTCATAAAGCCTACAATGTGGGAAACATTGTCTTTT
TATCTTTTTAATAGCAATAAAATGAATTCTTTTT
Sequence Type mRNA
Unitrap ID UNI30398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116855696..116856049 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031022 (BC051019) NM_001040700 Uncharacterized protein C11orf16 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9JJR6]

 
Come back to gene ENSMUSG00000031022


For any suggestions or comments, please send an email to unitrap@crg.es