Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_399E9-3
Clone ID CMHD-GT_399E9-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_399E9-3
Sequence
TGCCAGGTGGAGCTCAACAGGAAAGTTCTTGTGGACCTGGCCATCTATGAACCAAAGACGTTTAAATCTTTGGCTGCATT
GGCTAAGCGGAGGCAGCAGGAGGGATTTGCTGCAGCTTTGGGGGATGGAAAGGAGCCTGAAGGTATCTTTTCCAGAGTGG
TGCAGTACCACTGAAGGCTGCAGTGCTATAGACTGTTATAAACAAGATAGGACCAAAAGGACTGTCATCAGTAAGTCTGA
TTTGTATTTATTTACATTTTAGCAACAGGCCTGAGACGACAGGTCTTTATTCAGTGACACGGCCCCAAACTGTCCTGTAA
AGATTGTATAAATAAAGCCTTTGCAGTGTT
Sequence Type mRNA
Unitrap ID UNI2287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155182588..155182937 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029066 (Mrpl20) NM_025570 mitochondrial ribosomal protein L20 Gene [Source:MGI (curated);Acc:Mrpl20-001]

 
Come back to gene ENSMUSG00000029066


For any suggestions or comments, please send an email to unitrap@crg.es