Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_398C10-3
Clone ID CMHD-GT_398C10-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_398C10-3
Sequence
TTGGAAAGCCAAAGAACCAGGTGATCAGTGCTTGTCGGGATGCGATTCGAAGCAACAACATCAACACCCTCTTCAGAATC
ATGCGAGTGGGCACTGCTCCTTCATAGGAGACAGGGAAAGAGGAAGGAAGCCCCTGCAAAAGGTCTAGACACGGAGCCTG
GCTGGCTCCCGATCACAGCCTGGGCATCCAGCTGCTAAGGATGAAACCATGCTAACTGATACAGCTAAGGACAAAGCACT
CCGGCTGAAAGCCTCCTTCATTGATATCAGTGGTGTTGCTGATTTGTATCTTAAAATATATCACCATTTCAGAATTTAAC
TTGTTTTTGTACATAAAGTTAGTGTATGAATTTATTCCCCCCGAAATTGTTACTGAAATTTAAAATGGAGTACCTACTTT
TTCATTAAAAATAAAAGGCACTGGTCTAC
Sequence Type mRNA
Unitrap ID UNI13612

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96591856..96592282 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031755 (Bbs2) NM_026116 Bardet-Biedl syndrome 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2135267]

 
Come back to gene ENSMUSG00000031755


For any suggestions or comments, please send an email to unitrap@crg.es