Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_397C11-3
Clone ID CMHD-GT_397C11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_397C11-3
Sequence
GCTTTTGATGTCCCCATTGAAGAGGGCCCAGTATTCAGAACAGGAGCAAAGGGGCCTATTCTATCCATCTACTTCCGAGA
TCCGGACAGAAATCTCCTTGAGGTGTCCAGCTATGTCACTTCATGATTGACACTGGCTTTTTCTTCTATTGTGATCCACA
AAATGTCATTTTACCTAATTTCCTACAAATCCCAGAGACCTCGAAGAACTGAGAACTTCGGCAACAGGTTTATGGTGCAA
ACGTTTGTGTCTAGAAAGCCTCCATTCAAGCTACTCCAATAAACGACAAATCTCTCC
Sequence Type mRNA
Unitrap ID UNI22619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7581332..7581628 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es