Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_397G3-3
Clone ID CMHD-GT_397G3-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_397G3-3
Sequence
ACTGTGAAGAAGGTCAAGAGGATGGCTCAAGGAATGAAACACCTTTTTCTACAAGTGAAGACTCTGATTTAGAAACGGAA
ACGGTCGAGCTTGGTGGAGGGTTTTATGTGAAATCATTTTTAAAGTATTCAGAAAATTCTGTCCCAGCCACTCAAAGGTT
CCTGACCTATCTGAAGTCATGGACTGGTGGGCCTGGCCCGCAAGCGTGAACAGCTGCTGAATTCTGCAAACAAGGACTTG
GCTCAGTATTTGATAGATGCCTTGATTTCCATTTCATGTATTTAATTTAATTTAATAAAATATAAGCATTAAAAAAG
Sequence Type mRNA
Unitrap ID UNI16824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144420784..144421098 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074754 (Gm561) NM_001033297 gene model 561, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685407]

 
Come back to gene ENSMUSG00000074754


For any suggestions or comments, please send an email to unitrap@crg.es