Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_398G5-3
Clone ID CMHD-GT_398G5-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_398G5-3
Sequence
AAGACAACCTCGGCTGCTTCTCAAGGGGGATGCAGACACCAGAACTAACTCTCCAGACCTGGACAGTCAGTCGCTGTCCC
TCAGCAGCGGGACTGACCAGGAACCTCTCCAAAGAATGGCAGGGGACAGCCTCTACTCACGTGAGTGGCTCTTCTGAAGC
CCACAGGAGACTGCCAGCGAAGGGCCCCCTACTGAGCGGGCCCCCAGATCTCAGCTTTATTGCTCCCCCCCAATTAAGCC
TAAGAGCTAGCAACAGCATGTAACCCTAACATTTGGATGGCAGAAAGATTGCTGTGAGTTTGAGGCCAGCCTGAGCTACA
TAGTGAGACTCTGTCTTAAAAATAAAATTAAAACAAAACC
Sequence Type mRNA
Unitrap ID UNI30402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 36200475..36200833 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029095 (Ablim2) NM_177678 actin-binding LIM protein 2 Gene [Source:MGI (curated);Acc:Ablim2-007]

 
Come back to gene ENSMUSG00000029095


For any suggestions or comments, please send an email to unitrap@crg.es