Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_396G8-3
Clone ID CMHD-GT_396G8-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_396G8-3
Sequence
CTGACTTCCCTTGATGCTCCCCGTCTTCCCCCTTGTAGAGACGGTGTGGTCCTGATGACTCTGGACTATGGTGACTTAAA
AGAAAAGCTTATTTCTCTTAATGTAAATTTTGAAAGACTTTTGTATTTTTGTGGTTCAAGTTTAAAATGAAAAATTTGAG
TTACAAATTGTATATATGACTGTGACATTTTTTCTGAATGTTTGGATTATCTATTTTTGCTTTATTGTATACTTTCTGTA
TGTGTGAACTGTTTGTAGAATAATTTTCACTTATAGATTTCTAGAGCTGTTTCAGTTCTAAGCTTACCTGTCATTTTTCC
CTTTTCCTGTAATTGTCCTCTCCTGCCAAGCAGCAGAGCTGTGCCACTGTAAATAGGCAGTCTCTAAAGTTACACAATGG
AAAACAGTTATGTACAGGGTATTTTAAAATGTCCTAGGAAGTAAATTATGCCTCGGTTGTGAAAAGC
Sequence Type mRNA
Unitrap ID UNI13336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79947860..79948326 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017550 (Atad5) NM_001029856 ATPase family, AAA domain containing 5 Gene [Source:MGI (curated);Acc:Atad5-001]

 
Come back to gene ENSMUSG00000017550


For any suggestions or comments, please send an email to unitrap@crg.es