Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_397H4-3
Clone ID CMHD-GT_397H4-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_397H4-3
Sequence
GGGAGCTGCCAGCCCGGACCGGAAATAAGAACATAACACCTTAACTCCCCATTCCCCCTGCAAGCGCCCGTCCTGGACAA
CGCTTTGCGCGCCTTTCCCTCCGAGATCAATAACCGCACCCTGCACCCTCCCTCCGGGGAACTGATTACAACAACCGGCC
TTCCCTCCTCGGGTCACTAAATTCTCCACTTCGACCTTTCCTCCCGCCCACTCCCCGAAAGCACGTGCAAAAACGGGTAA
AACGGTCTTGGTAGCTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAATTCTTGTTTTTCCCCCCTGTAAAAAAATAG
GCTGATCTTTGCCGGCAAGCAGCTGGAAGATGGCCGCACCCTCTCTGATTACAACATCCAGAAAGAGTCAACCCTGCACC
TGGTCCTCCGTCTGAGGGGTGGCATGCAGATCTTCGTGAAGACCCTGACTGGCAAGACCATCACCCTGGAGGTGGAGCCC
AGTGACACCATCGAGAACGTGAAGGCCAATATCCAGGATAAAGAGGGCATCCCCCCTGACCAGCATAGGCTGATCTTTGC
CGGCAAGCAGCTGGAAGATGGCCGCACCCTCTCTGATTACAACATCCAGAAGGAGTCAACCCTGCACCTGGTCCTTCGCC
TG
Sequence Type mRNA
Unitrap ID UNI18917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62351940..62366322 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019505 (Ubb) NM_011664 ubiquitin B Gene [Source:MGI (curated);Acc:Ubb-001]

 
Come back to gene ENSMUSG00000019505


For any suggestions or comments, please send an email to unitrap@crg.es