Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_398E6-3
Clone ID CMHD-GT_398E6-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_398E6-3
Sequence
CCTTTGTGACTGCACTGTGATGGTTGGTGGTACCCAGTTCTTGGCCCCTCGGGCTGTGCTGGCCTCCTGCAGCCCATTCT
TTCAGCTTTTCTACAAGGAGCGGGAATTGGACAAGAGGGACCTGGTGTGTATTCACAATGAGATTGTCACGGCCCCAGCC
TTTGGGTTGCTTTTGGACTTTATGTATGCTGGCCAGCTGGCCCTTAGGGGAGATACTCCTCTAGAAGATGTGCTGGCAGC
TGCCAGCTACTTGCACATGAATGACATTGTTAAGGTTTGTAAGCAACGATTGCAGGCCCGAGCTCTGGCAGAGGCAGACA
GTACC
Sequence Type mRNA
Unitrap ID UNI30406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8877580..8877904 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071661 (Zbtb3) NM_133759 zinc finger and BTB domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1922541]

 
Come back to gene ENSMUSG00000071661


For any suggestions or comments, please send an email to unitrap@crg.es