Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_391G12-3
Clone ID CMHD-GT_391G12-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_391G12-3
Sequence
GGGGAAGGACTTGTAAGAGCAACATGACAAGAAAGCGTGTGAGAGGGAGATGCAGCGAATCACCTTGCCCCTGTCTGCCT
TCACAAACCCCACCTGTGAGACCGTGGATGAAAACACCATCATTGTGCACAGCAACCAGACTCCTGCTGACGTGCAGGAG
GGCAGCACCCTCCTCACGGGCCAGGCTGGCACCCCTGGGGCCTGAGCCCCTTCAGTGGGCAGGTGCCCATGTAAACACTG
GTACAGGACAGGCCACCCTCCTGCAGTTGGGAGGAGCTACATTTTGTGTTGTGGTTAAAACCTTATCCCATTTTTCTTTT
GGGGGGAATGTGACTCCTCATGACACAAGAAGATGCAGGTAGCATTATGGGTGAGGGTGAGGAGGCTGGGTAGGGTCCTA
TCAACGCTCCTTTTCTATCCCTTGGAGCAGAATTTGCCTGCGGAGAGAGACTGGCACAGTAGCCACAGTGGTGCTGTGGC
AAATAAGGGCTTCCACATTGCCTGGGCCAAGGAAAGACTGGGAGCTGGCTAAAGCTCTTCTGTCCTGTATACTGAAGAAG
GTGGCCTCAGTCTCTGCTTTTCCATTCGTCATCCAGGAACTTGAGTGGCATATACTGTTATTCCTAGTTAAGGTCAAGC
Sequence Type mRNA
Unitrap ID UNI13104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3241526..3242164 635
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034614 (Pik3ip1) NM_178149 phosphoinositide-3-kinase interacting protein 1 Gene [Source:MGI (curated);Acc:Pik3ip1-001]

 
Come back to gene ENSMUSG00000034614


For any suggestions or comments, please send an email to unitrap@crg.es