Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_393E7-3
Clone ID CMHD-GT_393E7-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_393E7-3
Sequence
ATTTCTTCCCTGCTTCCATATAAATTCCCGGGCTGGAGCCTCCTGGTGGACCCGACCTCCTGGACGATGGCTTTGCCTAT
GATCCTTCTGCCCCCACGCTCTTCACTATGTTGGACCTGCTGCCCCCAGCACCACCACTTGCCAGTGCTGTGGTGGGTAG
CGGGGGTGCAGGGGCCACCGTTGTGGAGTCTTCTGGCCCAGAGCCCCTGTCACTGGACTCTTTTGCAGCGCCGGGCCCCG
GGGATGTTGGTACTGCTAGCCTTGTGGGCAGCAACATGTTTCCCAACCAGTACCGAGAGGCAGCTTTCGGGGGTGGCCTC
CTATCTCCAGGGCCTGAAGCCACGTAGCCTCTGAGGTAACAGAGGAGGCACTGGGTGAGGTATGTGGTATAGCACTCCAT
TCCGAAGCCAACCTTGATCAGTCTTCCAGCTTCCTCATCCTGAATCGGACATCTGCAGCGCTGGTGGGAAGATGGGGAGC
ACTCCGGTTCTCTTTGAGCCCATTTTACAGAATGCTGAGTCCGAAGAGGAAAAGGGGCTCCTGCAGATGGACCCCTTCTC
AGGACAGATTCTCAGAGATTGTACATAGGGGAGGAGGGAACAGATTCCCCAGCCTTCTCCCC
Sequence Type mRNA
Unitrap ID UNI30409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20191628..20192248 602
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es