Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_387H8-3
Clone ID CMHD-GT_387H8-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_387H8-3
Sequence
GTCAACTTCTCTCATAAGGGCAATGTTTTTGTTTTTGATCTGGAAACGTCTGCGGTCGCTCCCTTTGTTTGGTTGGATGT
AGGAAGTATCCCCGGGAGATTTAGTGATAACGGCTTCCTCATGATTCGGAAGAAACTCTCGGTACTGTTTTACCCTTGGA
AGCCCACCAGCAAGAGTGAGCTGCAGCAGGCCTTCAGCGTCACCTCCCTGACGGATACCTACTGAAGGGACATGGCTTGT
AATTCAGTGGACACTGGGGACAAAGGCTTTCTAAAGCATGGCTGGAGAAGAAGGCAGCCTGAGATAAAACCGTCAAGAAG
TATCTGCTGCCTGGGGTGCTATGACTTCCCAGTGAATACTGGTTCATCCTGGTGATGTCTTTAGACAAGGTCATGCCCGG
GGATTCTTGAATCTCCCAGGATTGTGGTTTTGTCCCACAGCTAAAGCACGGCCAGAAGACTCATACCACCCAATGACCTT
TTTGGGAGACCACTAGACTGTGACATGATTGTGTGGAACCAAATGTGGAGTATCTGAAGTAATGTAGGCCTTTCATAGCA
CCAGGAATTCTACCCACTGTAGGTGAAGTGTGTGGCTAGGATTGCCAGAGGAAATGGGAACTCAGATCCTACAATAGAGA
TTGCTTGATGGCAGCCATATTGATTGTTGGTAGACAGCTAAGGGGCCTGAATGTTGT
Sequence Type mRNA
Unitrap ID UNI21187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135233179..135233874 683
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es