Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_388B12-3
Clone ID CMHD-GT_388B12-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_388B12-3
Sequence
GTGTGGCCCATCTCCTGTACACTCGGAGCGACCTTTGGCTACGTGGCTGGCCTGGTTATCGCGCCACTCTGGATCTACTG
GAATGGAAAGCAGCTTACATACTAGAACAATTAAGAGGAGAAAGGAGAGAAGTTATTTCTCTGTGCAGATTCCATAAGGG
CTGTGCAGAAGTTACATGGTCCAAGCCGGGCAGTCCATTTACAGCACTGTTGTTTTCTAAATGTCATTTCAACATGATGT
GATTGTAGCTTTTTAACTATGAAACCCCTGAGAGATTGTACCTTCTAGTTGAAATAAAGTATTTATAGT
Sequence Type mRNA
Unitrap ID UNI3240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87396599..87396907 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024145 (Pigf) NM_008838 phosphatidylinositol glycan anchor biosynthesis, class F Gene [Source:MGI (curated);Acc:Pigf-001]

 
Come back to gene ENSMUSG00000024145


For any suggestions or comments, please send an email to unitrap@crg.es