Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_388D1-3
Clone ID CMHD-GT_388D1-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_388D1-3
Sequence
GTCAGATGTGCATTTTGCTTTTATAAATCCTATATCATTGAGCCCTTTTGGGATCTGTCCCTGGAATTCCCTGAACGATG
CCACTGCAGAGAACAGGGGTTTGTCCCTTTGAATCAGACAGAGTGCCTGCTCACTGATATGCTGGCCTAGTTCACCGAGA
CAGAGGCCCTGGAGGGGAGAATCTACGCTTGTGACCAGTGTAACAGCAAACGACGAAAGTCCAACCCCAAACCCCTTGTT
CTGAGTGAAGCTAGGAAGCAGTTAATGATCTACAGACTACCTCAGGTCCTCCGGCTACACCTTAAAAGATTCAGGTGGTC
TGGCCGTAACCATCGTGAGAAGATTGGGGTCCATGTCATCTTTGACCAGGTATTAGCCACGACACCTTACTGCTGCAGGG
ACATGCACTCCTCGTTTAAGAAATATACCTTTGCCTATAATCTCTCCTCATTGATCATGCATCACTGGTTCGGGTTT
Sequence Type mRNA
Unitrap ID UNI28213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47811665..47816775 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023984 (Usp49) NM_198421 ubiquitin specific peptidase 49 Gene [Source:MGI (curated);Acc:Usp49-001]

 
Come back to gene ENSMUSG00000023984


For any suggestions or comments, please send an email to unitrap@crg.es