Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G038B07
Clone ID G038B07
Vector U3CEO
Project ggtc

Sequence tag G038B07
Sequence
CNNNCATTCGTTTTACGAAACCTCCGAGGTACAAGTGTGGGATCTCAAAGGCGTGCCCAGAGAAGCATTTTGCTTTTAAG
ATGNNNAGTGGAGCAGCCAATGTCGTGGGACCCAAGATCTGCCTGGAGGACAATGTTTTGATGAGTGGTGTGAAGAATAA
TGTCGGAAGAGGAATCAATATTCCCTTGGTAAATGGGTCAACAGGGTAAGTAATAGACTCCATATTTTTTGACATGTGGG
GAGGAAATGTCCCCCCATTCAGTTAGTTGTNTAAATACACTATCCAAGTACAGAATCAATACAGCTACTGTCTACATACC
AAGATGTAGCACCCAA
Sequence Type mRNA
Unitrap ID UNI10553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22146974..22278677 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029672 (D6Wsu176e) NM_138587 Protein FAM3C Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q91VU0]

 
Come back to gene ENSMUSG00000029672


For any suggestions or comments, please send an email to unitrap@crg.es