Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_387A2-3
Clone ID CMHD-GT_387A2-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_387A2-3
Sequence
GCTCTATGGTTTCAAGATCCATCCAATGGCTTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAGAGAGCCCAGTCAAG
ACTATTCGCTGATTGCCCACCCACCTCTCCCTCTGTCTGTGACACCACCATTCCTCTGCTGCCACCCTTTCAGGAAGTCT
ATGGTTTTTAGTTTAAATTAAAGGAATTGTTACTGTGGTGGGAATATGAAATAAAGGAAGAAAAGGCCAGAAAAAAAAAA
AAAAAAAAAAAAAAACAGGCTTCCATGCTCTTAACGTGTCTGATGGCCTGGAGTCTCTCATTCTGCCCCCGGAGCTGGGC
TTGTCCATTGCCGACCTTCGCCAAATATACTTGTTCCTCAACAGTTCAGGACTTCTGGTCCTTCCCTGGGATAGACCCTG
ATGTGTTCCCCTTCCTAGATTCTGCTCTGTCTGAGAGACTCTTCCTTTGAGGGGCCCAGCATCCTGCTCTGCGGTCTGTG
AACACTCAGATCCTCTGAGCCCTCTGATCTCTTAAGCTTTCTGCTCTACATGGCCAAATTCTGTATGGCCCCTGGATCTG
GGGCTGGTTTGTCCTCCTCCTTTTCAGGAAACTTAAGGACGGTTCTCACCAAGGCTGACTTGACAATGAATCCCATTTTG
AGTGTCACTGTCTCCGTGTACCCTCAGTCTGGTCATATGCCATATCCGAGCCTCAGCAGCCAGGCCCAAGGGTGGACTTG
CATACCTTTACATCTGGCACAGCGACCTATCTCACTATCTCCACCATCCTGGGTCGCTGTCCTTGGTCTCATCAT
Sequence Type mRNA
Unitrap ID UNI18508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35250966..35253370 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024387 (Csnk2b) NM_009975 casein kinase 2, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88548]

 
Come back to gene ENSMUSG00000024387


For any suggestions or comments, please send an email to unitrap@crg.es