Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_386B11-3
Clone ID CMHD-GT_386B11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_386B11-3
Sequence
AACAGATGAGGCAGCTGGGGCTACTGGTGATGCCATCGAGCCAGCGCCCCCTAGCCAGGAAGCTGAGGCCAAGGGGGAGG
TCGCCCCCAAGGAGACCCCCAAGAAGAAGAAGAAATTCTCTTTCAAGAAGCCTTTCAAATTGAGTGGCCTGTCCTTCAAG
AGAAATCGGAAGGAGGGTGGGGGTGATTCCTCAGCCTCCTCGCCAACAGAGGAAGAGCAGGAGCAGGGCGAGATGAGCGC
CTGCAGCGACGAGGGCACTGCCCAAGAAGGGAAGGCCGCTGCCACCCCTGAGAGCCAAGAGCCCCAGGCCAAGGGGGCAG
AGGCTAGTGCTGCCTCCAAGGAAGGAGACACAGAAGAGGAGGCAGGGCCCCAGGCTGCAGAGCCATCCACTCCCTCGGGC
CCAGAGAGTGGCCCCACACCTGCCAGTGCTGAGCAGAATGAGTAGGGGTGGGGACAGGTGGGTGATCTCTAAGCTGCAAA
AACTGTGCTGTCCTTGTGAGGTCACTGCCTGGACCTTGTGCCCTGGCTGCCTTCCTGTGCCCAGAAAGGAAGGGGCTTGT
TGCCCCCTCCCAGCCACGCTCCCTTTTTGCCCTCCTGTGGATTCTCCCATCAGCCATTTGGTCTTACTCTTAAGGCCAGT
TGAAGATGGTCCCTTACGGTTTC
Sequence Type mRNA
Unitrap ID UNI14575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129192032..129192694 661
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047945 (Marcksl1) NM_010807 MARCKS-like 1 Gene [Source:MGI (curated);Acc:Marcksl1-001]

 
Come back to gene ENSMUSG00000047945


For any suggestions or comments, please send an email to unitrap@crg.es