Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_319G04-3
Clone ID CMHD-GT_319G04-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_319G04-3
Sequence
TGCAGGTGGTGTGCAAAAAGTACAGAGGCTTCACCATCCCAGAGGCATTCCGTGGAGTGCATCGGTACTTGAGCAACGCT
TATGCCCGGGAAGAATTTGCCTCCACCTGTCCAGATGATGAAAAGATAGAGCTAGCCTATGAGCAAGTGGCCAGGGCTCT
CAAATGAGCACTTTTTAAAGGGTCCTTCACCCACTCTGTGCTCTCCACAGAGGCTTCGGGGGGCTTCCACGTTGCTGCAT
AATGGACACACTCCGAAATTGCCAGTGGGCAGGAAATCCGGGGCACTTGTGGGGTGGGGCTGTGGGATAAGGCAAAGGAT
AGTGGACAAGGGTAAGATTTTTATTTTGGGATGGGGTGGGTAGGACAACGCATTTCAGTAATAAAATACAGAATG
Sequence Type mRNA
Unitrap ID UNI13575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35195273..35195664 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007041 (Clic1) NM_033444 chloride intracellular channel 1 Gene [Source:MGI Symbol;Acc:MGI:2148924]

 
Come back to gene ENSMUSG00000007041


For any suggestions or comments, please send an email to unitrap@crg.es