Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G031C08
Clone ID G031C08
Vector U3CEO
Project ggtc

Sequence tag G031C08
Sequence
ATCTAACACTCATCAGGACATTGAGGAGAAAGACCGGTTACTCCGCCATGTGGAAGCCAGAGATCTTATTGAGTTTGGCA
TGATACCAGAGTTTGTGGGACGGTTGCCTGTGGTGGTTCCTTTGCACAGCCTAGATGAGAAGACACTTGTACAAATACTG
ACCGAGCCACGGAATGCTGTTATTCCTCAGTATCAGGCCTTGTTCAGCATGGATAAGTGTGAGCTGAATGTTACTGAGGA
TGCTCTGAAAGCCATAGCGAGATTGGCCCTGAAAGAAGAACAGGTGCTCGAGGCCTTCGGTCTATATATGTGAAAAGCTG
TTACTAGAACCAATGTTCCCCGTCCCGANTNCCTGACATTGTTTGTGTCCATGTTAACGAGTAGCCGAGCGCCCGTCGAG
TTTCCGACCGCGCGTCCGGACGGGCCCGNNNNCNAGTGCGCTCCCGCCG
Sequence Type mRNA
Unitrap ID UNI10562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65170434..65174654 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015357 (Clpx) NM_001044389 caseinolytic peptidase X (E.coli) Gene [Source:MGI (curated);Acc:Clpx-001]

 
Come back to gene ENSMUSG00000015357


For any suggestions or comments, please send an email to unitrap@crg.es