Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_383H5-3
Clone ID CMHD-GT_383H5-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_383H5-3
Sequence
GTAGAGAAACAAAGAGACCACATCTGAGAGTGGAGCAGCCTGCCCCTGACCGCTGACCCTACCCAGCCCACCGGCTCTTA
CTGTCATCAGGAACTGGTTCCGAGACCCCCAAAGCCTCAAGGTTGTCCTCCAGTAAGGGTTTCTTGGAGCCCTGTCTGAG
GGGCCGAGTCTTGGCTGATGGGATTCTTTTCCCTATGAATAAAAATAAAAAAAAAC
Sequence Type mRNA
Unitrap ID UNI30423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81516617..81516832 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078961 (AC102262.9)  

 
Come back to gene ENSMUSG00000078961


For any suggestions or comments, please send an email to unitrap@crg.es