Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_382E11-3
Clone ID CMHD-GT_382E11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_382E11-3
Sequence
GTCGATCCTTCGGGACCCACAGTCTCATCGTGTCTCGGACAGGATGGCAGAGGGTACAGGTGGTGGTGATCTCCTGACAG
CTGGACCTCCCACAATGTGAAGCTCACGCTTGGGCTGCCCACTCTACCCTTCTCTTTCTCCTTCAGTAGAATAATAATTG
TTTTTCTAAACATTAAACCATCAAGACTTCTGAAGAGCAGAAGGCTACACTCTGAAAAGGAAA
Sequence Type mRNA
Unitrap ID UNI17078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129653510..129653729 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037885 (Stk35) NM_001038635 serine/threonine kinase 35 Gene [Source:MGI (curated);Acc:Stk35-001]

 
Come back to gene ENSMUSG00000037885


For any suggestions or comments, please send an email to unitrap@crg.es