Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_383A11-3
Clone ID CMHD-GT_383A11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_383A11-3
Sequence
ACATAGCCACCCACACAAATCATGCGGCTTTGTTCTCATCAAAGGACATGAAGTTGCTGCTTGCTGAAGATATTCTAGCT
GCCCTGGAGTTTCATAATGGGAAGCTGTGACTTGGGTGTCAATAAAGAGAGTTTCAACACCTGCC
Sequence Type mRNA
Unitrap ID UNI29036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148023725..148023868 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025481 (1190003J15Rik) NM_029821 RIKEN cDNA 1190003J15 gene Gene [Source:MGI Symbol;Acc:MGI:1916142]

 
Come back to gene ENSMUSG00000025481


For any suggestions or comments, please send an email to unitrap@crg.es