Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_381B12-3
Clone ID CMHD-GT_381B12-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_381B12-3
Sequence
TACCAGAGCCTTGCACGGTCCAGGCAAGTGCTCGACTACTGAGTTACGTGCTAACTTGGTCTGGGCTTCAAAGTCTCCAA
AGCTCCCCCAGGGAGCTGCCTTGGTCCCCTGTCTTCTCACCTGCTGCAGTAAAGAGCTTGTTCTTCCTCTCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAATGACCGTACTTTTCTCCCCCTAAAAAAAAATGGACTCCCATCTTCCCCCATAGGCTGCA
CCATGGGGATGCCTCCTGGGCACTGCTTTCCAGCTGGTGGGATATGGAGGCCTCCTGCCCCACCCTCTTTCTTTCCTCTC
TTATCTCTGGCTGCAGCCGCCTGGGTACAGATTCAGGCTCCAGCATCTTACCACACTGGGCAAGGAAGGCCATCCTCCCA
AAGACTGTGGGATCAGATACAAGGAAAGCAAACACGCATAGAAACTGGTAACTGATGGGCATCGTGGGGGTGGCAGGACC
AGGGTCACAGCTACTCTTGTGTGTACACAGACGGAGCTCCTAGATGCTCCCAGAAATGGACCTTCCAACACCATCCATGC
AGAACGATGGGAGGCCCGATACAGGGAAGGCTGGGGCTTGAGGTCCTGAAGCCTTGATGTGCTATGGTGGGTTGGAAGAG
CAAGGGGCCTTCAGGGAGGCCTTGGCACAGGCACAGGGATGCCATCGAACAAAATGCACAACACCAAACACCGGGAGAAC
ACCTG
Sequence Type mRNA
Unitrap ID UNI17020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147469562..147474911 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029005 (2610109H07Rik) NM_027426 RIKEN cDNA 2610109H07 gene Gene [Source:MGI Symbol;Acc:MGI:1917683]

 
Come back to gene ENSMUSG00000029005


For any suggestions or comments, please send an email to unitrap@crg.es