Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_384A9-3
Clone ID CMHD-GT_384A9-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_384A9-3
Sequence
ACTCATAAAACTAAACTGGAAGAGGATTTTAATTCGTCATCTAGAAGACATTCCTCTTGACGGTACAGCCGGCGGAATGG
AAGGACAGCGGAAATTTCCCATTCTTGAAGAAAAGGCCTTCAGTGTCCACGGAGCCCGAGGAAACCACATGGACTTTGGC
CAGCTGTATCAGTTCTTAAATGCCAGGGGATGTGGGGATGTTTTCCAGATGTTCTTTGGTGTATAAGGACAGTGACTGAG
CAGAGGGGAAGTCAGACCTGTTGGCTCACTGTTCCTCTGTTGATCATTTCTTCCTGTTTTTCCTTGAAATTCAATTTCAG
CTCCATTCTAGGATGTACTAGGGTTGGGGTCACAAGAAGAAAATTAATATGGCTGAAATGTATCAGTTAAAACTTGCCAT
GCCTGAGAGAAAAACTGGGTTTCGACTTGTAAGCTTTAAATTACTAAGTGAGAAGGGTGGAGAAATGACTCAGAAGTTAA
GAGCATATGCTGCTAGTGCCAAGGACCTAAGTTCAGTTCCCAGCACCCCTGGCAGGGAGCTCATAACTACCTATATGTCT
TTACTTCAGGGCATTTGATGTACTCTGTCCTCCAAGGGTGCATGCATGAACATAAACATGTAAATATATTTGGGGTATCA
GATCCCCTGGAGCTGGAGTTACAGGAGGTTGTGAGGTACCCGGTGTGGGTGCTGGGAGCCAAACTTGGGTCCTCTGCAAG
AGCAGTGCACCCTTTTAACCTCTGAGCCATCTCTACAGCTTGGTGGAAATTTCTTGACGTGAGCTGGATCTG
Sequence Type mRNA
Unitrap ID UNI13562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87434080..87434871 784
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es