Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_381H5-3
Clone ID CMHD-GT_381H5-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_381H5-3
Sequence
GAAAACGAGCGTTTGCTGGCAGAACCAGTTCCTGGGCATTAAAGCAGAACCAGATGAGAGCAACGCCCGTTATTTTCATG
TGGTCATTGCTGGCCCCCAGGATTCCCCCTTTGAGGGAGGGACTTTTAAACTTGAACTATTCCTTCCAGAAGAATACCCA
ATGGCAGCACCTAAAGTACGTTTCATGACCAAAATTTATCATCCTAATGTAGACAAGTTGGGAAGAATATGTTTAGATAT
TTTGAAAGATAAGTGGTCCCCAGCACTGCAGATCCGCACAGTTCTGCTATCAATCCAGGCTTTGTTAAGTGCTCCTAATC
CAGATGATCCATTAGCAAATGATGTAGCCGAGCAATGGAAGACCAACGAAGCCCAAGCCATAGAAACAGCGAGAGCATGG
ACTAGGCTATATGCCATGAACAATATTTAAGTCGATCAGATCATCGAGTGTACACCACTTCTCCTGTTCTGCCAAGACTT
CTTCCTTTTTTTGTTTGCATTTAATGGACACAGTCTTAGAAACATTACAGAATAAAAGCCCAGGCATCTTCATCTTTGGT
GATTACATGCACATTAGCAAATCTGTCTTGTCCTGATTCACTGTTGTAAAGCATGAGCAGAGGCTAGAAGTACCATCCGG
GTTGCTGAGAGATGCTGAGAAGCAGGACTCTCTGCTTTGACTCCTTCCCCATCATGGTTAAAGTACAAGGCACTG
Sequence Type mRNA
Unitrap ID UNI15833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 95003839..95005231 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074781 (Ube2n) NP_542127 ubiquitin-conjugating enzyme E2N Gene [Source:MGI Symbol;Acc:MGI:1934835]

 
Come back to gene ENSMUSG00000074781


For any suggestions or comments, please send an email to unitrap@crg.es