Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_381G2-3
Clone ID CMHD-GT_381G2-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_381G2-3
Sequence
CAAGCGCTACGAATCACAGCTTCGGGACCTCGAGCGGCAGTCAGAGCAACAGAGGGAAACCCTTGCTCAACTGCAGCAGG
AGTTTCAGCGGGCCCAAGCTGCAAAGGCTCCTGGGAAAGCCTGACCCCGTGGGAGGGGGTCAGGAGGGAGGGATGAGGCT
AACCCTGAGCCAATAAAATGTAAACAGAACC
Sequence Type mRNA
Unitrap ID UNI28770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34075866..34076056 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024309 (H2-Ke2) NM_010385 H2-K region expressed gene 2 Gene [Source:MGI Symbol;Acc:MGI:95908]

 
Come back to gene ENSMUSG00000024309


For any suggestions or comments, please send an email to unitrap@crg.es