Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_363E4-3
Clone ID CMHD-GT_363E4-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_363E4-3
Sequence
ACAGTGTCCATTCTGGAACAGCGACTGACACTAACAGAAGACAGGCTGAAGCAGTGCCTGGAGAACCAGCAGTTAATCAT
GCAGAGAACGCCACCGTGATGAGGGGAGCAAGGATCAGGAGCTCAGTGATTGGGGGGACAGCAGGCCAGGGATTTGTATG
GGGACTTGAGTAAATAAATAAAGGGATCCCACCTG
Sequence Type mRNA
Unitrap ID UNI1421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106252013..106252207 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es