Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_363A3-3
Clone ID CMHD-GT_363A3-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_363A3-3
Sequence
GCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTGCAAAGAGGCTTCCGACAAGTGCAGC
TGCTGTGCCTGAAGGGGGGCGGAGGGGTCCCCACATCTGTGTAAATAGACCATGTAGAAGCCTAGCCTTTTTTGTACAAC
CCTGACTCGTTCTCCACAACTTTTTCTATAAAGCATGTAACTGACAATAAAAGCCGTTGACTTGAT
Sequence Type mRNA
Unitrap ID UNI16352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96697236..96697461 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031762 (Mt2) NM_008630 metallothionein 2 Gene [Source:MGI Symbol;Acc:MGI:97172]

 
Come back to gene ENSMUSG00000031762


For any suggestions or comments, please send an email to unitrap@crg.es