Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_366A7-3
Clone ID CMHD-GT_366A7-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_366A7-3
Sequence
GGGTTGATAGCCCAGCTGCCGCAGGACGCTGGGTGCCAGAATCGCCCACCTGTGGATGGGGGCAGCCAGGTGCCCACAGT
GCTGGACACCCGCCGTGCCTGCCGGCAGCCTCCACCCCCACGCCTTCTCTGGCACCCCTTCACTGTCCCCTGCATCCCCA
CCATTCCCCAGACACTGGATTTAAGGCACACACAGCTGTGAGATGACTTCACATCGACCCCTTGTGCAGTGACCCGGATG
GTGCCCCACCCACACATGAAGCACCCACAGCTCAGCTGCCACCCTAGGCAACTCCTCCGGTTTCCTATCACTCTGCTCCT
GACCCGGGAGGTGAGAACAGGAAGCCCAGCCTTCAGCTCCCTTGGGAGTTTCCAGCCTCCCTCTTAAAGGCCACTAGGGT
TTCCAGATCCTATTTGAGAGTCTCCAGGCCTCCCCTGAAGGGTTCTAGCCACCACGCCCACAGGATTCCCATTAGGTTTT
AAAGTCTTTTCCAGAGTCCGCTGGTTCCCCTCCTCCTCACAAGGAAGGGCCTCAATTGTAGATAAGCGTTCCGGGTGGAT
CTTAGAGCCCTAGAGGGAGGCTTTTGCTTGTAACCCCCTAAAGATATTACTGGCACATA
Sequence Type mRNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74021686..74022303 606
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es