Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_379H7-3
Clone ID CMHD-GT_379H7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_379H7-3
Sequence
TTCTGAGGGACGTGCAGCTCAGCGACACTGGGGACTATTTATGCTCCCTGAATGATCACCTGGTGGGGACTGTGCCCTTG
CTGGTGGATGTTCCCCCAAAGGAGCCCCAGCTCTCCTGGTGCCGGAAGAACCCCCTTGGCAACGCCCTCTGTGAGTGGCG
TCCGACCCGCACCCCCTCTCCAACCACGAAGGCTGTGCTGTTGGC
Sequence Type mRNA
Unitrap ID UNI20749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89693118..89694248 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027947 (Il6ra) NM_010559 interleukin 6 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:105304]

 
Come back to gene ENSMUSG00000027947


For any suggestions or comments, please send an email to unitrap@crg.es