Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_378E12-3
Clone ID CMHD-GT_378E12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_378E12-3
Sequence
CGCGGAGGAAGAGATGTATCGCCCGCACCCGGCCTTCTACCGACCGCGTCTCAGCGACTGCTCCGACTACTCCGGCCAGT
TTCTGCAGCCCGAGGCGTGGCGTCGAGGCCGCAGCCCTTCCGACATCTCTAGCGACGTCTCCATTCAGATGACGCAAAAT
TACCCCCCGGCCATCAAGTACCCGGACCATCTCCACATCTCCACTTCGCCGTGCTGAGGCTGGAGTCCCTCCCTTTCCTC
TTTCTCCCTCCCCTCTCCCGCGCCTCACCCATGAAGCCCCAATTCCTTAAGGAACTCTAGGCTGAAGGATGCTGTGCCAT
CTCCAAGTTCCTACCCATCATCCTCATTTCAACGGCTCCACCCTTTTTCCAATCTCTCCTCACTGATTCATTATACTTCC
Sequence Type mRNA
Unitrap ID UNI13503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3366321..3366720 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es