Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_364A11-3
Clone ID CMHD-GT_364A11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_364A11-3
Sequence
GATGATTTTTCAGGATTGTCACCTTATGAAAGGAAGAGACTGAGGAACATCAGAGAAAATGCAAACTTTTTTGCTTCTCT
TCAGTTAGCTGAGTCGGCTGCACGGCTCCGTGGGATGATAAAGAAGCGCGAGTCACCTGAGTCAAAGAGAAAGAGGCCTA
AAAAAAAAAAAAAAAAAATTGGATGTCGAAGGTCCATGCGGTTGTTGAAAGTAAACCCTTTGGGAGTTTCATTACCAGCA
TCTCCAACACAGCCAACATTAGT
Sequence Type mRNA
Unitrap ID UNI17133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121343441..121351301 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es