Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_364A8-3
Clone ID CMHD-GT_364A8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_364A8-3
Sequence
GCTTTTTTTTTTCCCCCCCCCTTTTTCCAAAACCCCCCTTAAAATTGGGGGAAGGGGAAAAAAAAGAAACCAAGAAAAGT
CAGAGGTGTTCCTGCTGCTCTTCCATATAAAGTTCCTTGAGGCTGGTGCAGCCCCGGCGGTGCAGCTGGTGAAGGGGAGT
AGGAGGCATGGTGATGCTCCTCCAGACCGGCTCCCACCGCAGGACCATCGGGATGTGGTGATGCTGGACAATCTCCCAGA
TTTGCCCCCAGCTCTGCTTCCCGCTCCTGCAAAAAGAGCAAGACCGAGCCCTGGTCCCCCCCTGCCTCACGATGAAGACC
CTGAAGAGAGGCTGAACAGGCATGATCAGCACTTCACTGCTGTCTTGTCTAAGATTGTTGAACGAGATACAAGTTCAGTC
ACTGTGACTCTGCCTGTGCCCAGTGGTGTTGCTTTCCCGCCTGTGTTCCATCGCTCTCAGGAGAGACAGGTGAAACCCGC
AGCATCTGGTAAAAGGAGCATCTTTGCCCAAGAGATTGCAGCAAGAAGGGTGTCAGGAAACAGGGTGACATCAGCTGAGC
AAGTTGTCCCCAGCCTAGACACACCATAGGGTGCTGTGCCCTGTGAGACACCCTCCGTCAGGGACAGAAGCAACCAGCTT
CCTGGGAGGAGTCATGGCTTCCACAGACCAAATCTAGTCACAGGAAAGGGACTCAGGAGCAAGGTGGCTGAGCAGGA
Sequence Type mRNA
Unitrap ID UNI30443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119603948..119609622 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es