Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_364A12-3
Clone ID CMHD-GT_364A12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_364A12-3
Sequence
GTCCTCTACAGTCTTCAGGAGGAGCAAGCCAGGCTCAAGATGAGGCTGCAGGAGCTGCAGCAGCTCAAAAGGGAGCGCAC
AGGCTCTCCCGGAGCCAAGATCCCATTCTCAGTACCTGAAGTTCCTCTGGTATTCCAAGGCCAAACTAAGCAGGGCAGGC
AAGTGCCCAAGTTTGTAGTTTCTAACTTGAAGGTCTGCTGCCCTCTGCCTGAAGGTTCTGCTCTGGTCACCTTTGAGGAC
CCCAAAGTGGTTGATCGGTTGCTACAACAAAAGGAACACAGAGTTAACTTAGAGGACTGCTGGCTGCGGGTGCAGGTCCA
GCCCTTGGAGCTGCCTGTGGTGACCAACATTCAGGTGTCCAGCCAGCCAGATAACCACAGGGTGCTCGTTAGTGGTTTTC
CTGCTGGACTTAGGCTGAGTGAAGAGGAACTGTTGGACAAGCTGGAGATCTTCTTTGGCAAGGCCAAGAATGGAGGTGGG
GATGTAGAGACCCGGGAGATGCTGCAAGGGACCGTCATGCTAGGGTTTGCTGATGAAGAAGTGGCCCAGCACTTATGCCA
GATTGGCCAGTTCAGAGTCCCACTGGACCGGCAGCAGGTCCTCCTGAGGGTCTCTCCCTATGTGAGTGGTGAGATCCAGA
AAGCCGAGATCAAATTCCAGCAAGCCCCTCATTCAGTGCTGATGACAAATATTCCTGATGTCATGCATGCCCAGGAACTG
CATGACATCCTTGAGATCCACTTCCAGAACCCCACTCG
Sequence Type mRNA
Unitrap ID UNI13181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101317880..101319624 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010358 (Ifi35) NM_027320 interferon-induced protein 35 Gene [Source:MGI (curated);Acc:Ifi35-001]

 
Come back to gene ENSMUSG00000010358


For any suggestions or comments, please send an email to unitrap@crg.es