Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_330E11-3
Clone ID CMHD-GT_330E11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_330E11-3
Sequence
GATCCGGCGCTAAGAAACCGGGCGAGGACTTAGCGGATAATGACGGGGATGAAGATGAAGACATCCGAGACAGTGGTGCT
AAACCTGTCATGGTCTACATCCACGGAGGCTCTTACATGGAAGGAACAGGCAACATGATTGATGGGAGTGTTCTTGCAAG
TTACGGCAACGTCATCGTCATCACCCTCAACTATCGGGTCGGGGTGCTAGGTTTCCTGAGCACTGGAAATCAGGCTGCCA
AGGTCAACTATGGGCTCCTTGATCAAATCCAGGCCCTTCGCTGGGTGAGTGAGAATATTGCCTTCTTTGGAGGAAATCCC
CGTAAAATTACTGTCTTTGGCTCTGGCATCGGTGCATCCTGTGTCAGTCTCCTTACACTGTCTCATCATTCTGAGGGGCT
TTTCCAAAGGGCCATCATCCAAAGTACTCTGCGTTGTTACCACTGC
Sequence Type mRNA
Unitrap ID UNI30459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98502414..98513304 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031302 (Nlgn3) NM_172932 neuroligin 3 Gene [Source:MGI (curated);Acc:Nlgn3-002]

 
Come back to gene ENSMUSG00000031302


For any suggestions or comments, please send an email to unitrap@crg.es